Genome Analyzer: PhiX control lane
The phi X 174 (phiX) bacteriophage genome is a circular DNA molecule of 5386 bases.
A PhiX library is used as a control lane to validate the quality of each run.
The PhiX lane is also used as reference by the GAPipeline base-calling software.
The sequence files are provided under solexa fast-q format:
@HWI-EAS210R_0001:4:10:890:1010#0/1
GTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGA
+HWI-EAS210R_0001:4:10:890:1010#0/1
gggggggggggggghgggggggggfggggggggggggg
@HWI-EAS210R_0001:4:10:890:1780#0/1
GAGGCCTCCACTATGAAATCGCGTAGAGGCTTTGCTAT
+HWI-EAS210R_0001:4:10:890:1780#0/1
ggfhggggggggggggggggghgggggfggggggdggg
Where "@HWI-EAS210R_0001:4:10:890:1010#0/1" is the sequence name:
- instrument (HWI-EAS210R_0001),
- channel (4),
- tile (10),
- X-position (890),
- Y-position (1010),
- read one no index (#0/1)
and "ggg" the Phred-like quality value of each base, encoded as ascii code minus 64:
- "f" = 38,
- "g" = 39
- "h" = 40
The sequence files can be very large and linux scripts are commonly used for their analysis.
We provide here an example of reads from a single-reads 1x38 bp PhiX channel:
- 50'000 reads (1.6 KB zipped) or
- one full channel 11'143'905 reads (324 MB zipped, please contact us).
|
|
PDF 
